FastQCFastQC Report
Fri 3 Jun 2016
OM28_S7_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameOM28_S7_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1981957
Sequences flagged as poor quality0
Sequence length151
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTATACACATCTCCGAGCCCACGAGACCGTACTAGATCTCGTATGCCGT24780.12502793955671088No Hit

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCTAGA2252.6532398E-522.5555571
GTGCTAG4601.7826096E-1020.489131
TCTAGAG2608.0824175E-519.5192322
TCTTAGA5107.075869E-1018.4803922
ATCTAGA2900.003755199715.01
CTAGCAC4001.3023037E-414.53
TAGATTG6151.4092984E-714.1463425
TGCTAGG4101.6064434E-414.1463412
ATATTAG8201.2914825E-1014.1463411
GTATTAG5658.360839E-714.1150451
TAGGACA3609.664932E-414.0972224
ATATAGG7305.4023985E-913.904111
ATCTAGC4703.284905E-513.8829791
CTCTTAA10950.013.242011
GTTAGAC3850.001604110413.1818193
GTGTAGG5551.0771193E-513.0630641
ACGTAAG5005.8748563E-513.0500011
TAGCACT7257.390736E-813.04
ATCATAG8453.0304363E-912.86982251
ACAGTAC5107.0726936E-512.7941178